NAME:
Dr. Milo Thaddeus Pinkerton IIIBIRTHDATE: unknown. Dr. Pinkerton is a CANCER.
HEIGHT: 5'8" (bad hair day) 5'11" (good hair day)
HAIR COLOR: black. Dr. Pinkerton suffers from a rare condition known as 'H.M.H.' or 'Heavy Metal Hair.'
EYES: eyes?
WEIGHT: 135 lbs (7,138,491,034 lbs in Gravitomic Accelerator... when the Accelerator is energized, Dr. Pinkerton can affect the orbit of the Earth just by using his pinky to scratch his brain!)
GRADUATED: 1994, phD in EVIL SCIENCE, from Malign Mastermind University
FAVORITE COLOR FREQUENCY: 670.234 nm (blood red - the color of a successful experiment!)
FAVORITE AUDIO FREQUENCY: 2347.532 Hz (I could listen to it for at least a fortnight!)
FAVORITE DRINK: M.I.L.K. (it's good for bones and teeth.)
LAST BOOK READ: 'The Effect of Gamma Rays on Man-In-the-Moon Marigolds,' Zindel, 1969
BOOK REVIEW: "The vagueness of scientific specifics in the book rendered it almost completely worthless! Why, in less than half the time I spent furrowing through the first two chapters, I could have placed the potted plant in front of the gamma-ray emitter, flipped the switch, and been done with it! Nevertheless, the experiment could not be judged a total failure. When the gamma-ray bombardment began, the flowers began to blacken and wither... The aforementioned book, abandoned within range of the beam, burst swiftly into flame, degenerated into ash, and eventually was carried by spare drafts of wind near the lab bench to the floor, which thereby became soiled, much the the consternation of the Death Roomba. Within 6.35 seconds, the entire Marigold plant was reduced to a viscous brown sludge which, when ingested by a test subject, caused him to collapse on the floor, writhe in a spasmodic fit, then completely lose consciousness. When Filbert regained awareness, he observed that the substance, though vile, was 'not as bad as Pepsi One.' Further testing is indeed in order..."
HOBBIES: Currently undertaking 'Taking Over the World'. Other interests include 'World Domination', pinball, and the 'Destruction of the Earth'.
QUOTE: "The only thing we have to fear is... ME!
Moooohahahahahahahahahaha! ha! ha. heh. heh. hurmph."
DNA SEQUENCE: GATAGGACTATACCATAGAACCATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGTGACTTTTGACATGACTAGATAGGACTATACCATAAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACAGATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCACAATAGATTACGATAGGCCAGATACCAGACTACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACAATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTTTAAAGATAGGACTATACCATAGAAACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGACTACCAGATACCAGATTAATTTGGACTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACGCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACATCCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACACGATACCAGATACCAGATACCAGATTAATTGGACTTTGCAACATGACTAGATAGGACTATACCATAGAACCATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGTGACTTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACAGATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCACAATAGATTACGATAGGCCAGATACCAGACTACCAGATTAATTGGACTTTGACCATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATFACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTTTAAAGATAGGACTATACCATAGAAACATTAGACATTTAGACACCACAAATACGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGACTACCAGATACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGACTTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACACGATACCAGATACCAGATACCAGATTAATTGGACTTTGCAACATGACTAGATAGGACTATACCATAGAACCATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGTGACTTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGQATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACAGATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCACAATAGATTACGATAGGCCAGATACCAGACTACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACFCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTTTAAAGATAGGACTATACCATAGAAACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGACTACCAGATACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACGATACCAGATACCAGATACCAGATTAATTGGACTTTGACATGACTAGATAGGACTATACCATAGACATTAGACATTTAGACACCACAAATAGATTACAGAGATTAGGACCCCAATAGATTACACGATACCAGATACCAGATACCAGATTAATTGGACTTTGCAACATGACTA...
Tell ya what. Why don't you clear off 130 gigs or so of hard drive space, then I'll email you the rest of the sequence in a ZIP file.